reduced results from

147 billion

41 million

407690

531

to ~69 options

options split into images, definition, symptoms, related diagnoses, diagnostic tests, therapies, and medications

what is 'hepatic phosphorylase in the liver'? Definition for hepatic phosphorylase in the liver hepatic phosphorylase in the liver is a medical procedure used for such diagnoses as: glycogen storage diseases. related diagnosis for 'hepatic phosphorylase in the liver' 1 - 1 of 1 diagnosis glycogen storage diseases type of storage disease due to accumulation of glycogen in tissues hepatic phosphorylase in the liver and glycogen storage diseases related procedure for 'hepatic phosphorylase in the liver'/associated diagnoses 1 - 5 of 59 procedures Abdominal CAT Scan hepatic phosphorylase in the liver and Abdominal CAT Scan Abdominal MRI MRI of abdominal contents hepatic phosphorylase in the liver and Abdominal MRI Activated partial thromboplastin time hepatic phosphorylase in the liver and Activated partial thromboplastin time Amniocentesis hepatic phosphorylase in the liver and Amniocentesis Arterial Blood Gas hepatic phosphorylase in the liver and Arterial Blood Gas BUN hepatic phosphorylase in the liver and BUN Biopsy liver hepatic phosphorylase in the liver and Biopsy liver Carcinoembryonic Antigen (CEA) hepatic phosphorylase in the liver and Carcinoembryonic Antigen (CEA) Chorionic Villus Sampling (CVS) hepatic phosphorylase in the liver and Chorionic Villus Sampling (CVS) Complete Blood Count hepatic phosphorylase in the liver and Complete Blood Count Complete metabolic panel hepatic phosphorylase in the liver and Complete metabolic panel ECHOcardiogram hepatic phosphorylase in the liver and ECHOcardiogram EKG Electrocardiogram hepatic phosphorylase in the liver and EKG Electromyogram (EMG) hepatic phosphorylase in the liver and Electromyogram (EMG) Enzyme replacement hepatic phosphorylase in the liver and Enzyme replacement Forearm ischemic exercise test hepatic phosphorylase in the liver and Forearm ischemic exercise test Hepatic ultrasonography hepatic phosphorylase in the liver and Hepatic ultrasonography Lipoprotein Electrophoresis hepatic phosphorylase in the liver and Lipoprotein Electrophoresis Lipoprotein Phenotyping hepatic phosphorylase in the liver and Lipoprotein Phenotyping Liver Function Tests elevated liver enzymes hepatic phosphorylase in the liver and Liver Function Tests for more please login, login is free (click to login) related medication for 'hepatic phosphorylase in the liver'/associated diagnoses 1 - 5 of 59 drugs alglucosidase alfa hepatic phosphorylase in the liver and alglucosidase alfa allopurinol hepatic phosphorylase in the liver and allopurinol captopril hepatic phosphorylase in the liver and captopril enalapril hepatic phosphorylase in the liver and enalapril ferrous sulfate hepatic phosphorylase in the liver and ferrous sulfate filgrastim hepatic phosphorylase in the liver and filgrastim glucagon hepatic phosphorylase in the liver and glucagon lisinopril hepatic phosphorylase in the liver and lisinopril ramipril hepatic phosphorylase in the liver and ramipril for more please login, login is free (click to login) The following are types of physicians relevant for 'hepatic phosphorylase in the liver'. related types of physicians 'family practitioner, genetics specialist, internist, metabolic specialist' show local physicians postal code Find Local stars represent relevance to topic not rating more The results are computer generated suggestions to help you find a physician. MEDgle does not recommend any particular type of physician or claim to be complete or accurate in the providers and specialties suggested. web search results for 'hepatic phosphorylase in the liver'? Results 1 - 50 - hepatic phosphorylase in the liver Activation of hepatic glycogen phosphorylase b in vivo by sodium ... In both rat strains the activity of glycogen phosphorylase in liver extracts was ... Rabbit-liver phosphorylase: improvement of the purification procedure and assay ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1147309   www.pubmedcentral.nih.gov - summary Mutations in the liver glycogen phosphorylase gene (PYGL) underlying ... Deficiency of glycogen phosphorylase in the liver gives rise to ... A. Biochemical diagnosis of hepatic glycogen storage diseases: 20 years French experience. ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=EBI&pubmedid=9529348   www.pubmedcentral.nih.gov - summary eMedicine - Glycogen Storage Diseases Types I-VII : Article by Ljubomir ... von Gierke1 described the first patient with GSD type I in 1929 under the name ... hepatic phosphorylase in the liver and phosphorylase b kinase in the liver, ... http://www.emedicine.com/derm/topic723.htm   www.emedicine.com - summary PHKA2 - Wikipedia, the free encyclopedia ... associated with mutations in the human liver phosphorylase kinase alpha subunit. ... mutation in four Japanese patients with hepatic phosphorylase kinase ... http://en.wikipedia.org/wiki/PHKA2   en.wikipedia.org - summary MIM Gene map Phosphorylase kinase deficiency, liver (glycogen storage disease type VIII) 306000. Glycogenosis, X-linked hepatic, type I (3); Glycogenosis, X-linkedhepatic, ... http://www.ncbi.nlm.nih.gov/Omim/getmap.cgi?l311200   www.ncbi.nlm.nih.gov - summary eMedicine - Glycogen-Storage Disease Type VI : Article by Lynne Ierardi ... ... hepatic phosphorylase kinase, X-linked liver glycogenosis, type 6 glycogenosis, ... In general, GSD VI is caused by defects in the hepatic glycogen ... http://www.emedicine.com/ped/topic2564.htm   www.emedicine.com - summary hepatitic steatosis Prev Term: hepatic phosphorylase kinase deficiency. Next Term: hepatitis. hepatitic steatosis. Use: fatty liver. Send your comments to: Melody Lowe ... http://crisp.cit.nih.gov/Thesaurus/00021376.htm   crisp.cit.nih.gov - summary Lack of vasopressin receptors in liver, but not in kidney, of ob/ob mice. The hepatic angiotensin II receptor. ... The liver angiotensin receptor involved in the activation of glycogen phosphorylase. ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1152526   www.pubmedcentral.nih.gov - summary Hepatosplenomegaly - Wikipedia, the free encyclopedia Glycogen storage disease type 6A, due to phosphorylase kinase deficiency ... enlarged liver ... Hepatic fibrosis, congenital ... enlarged liver ... http://en.wikipedia.org/wiki/Hepatosplenomegaly   en.wikipedia.org - summary eMedicine - Glycogen Storage Diseases Types I-VII : Article Excerpt by ... Hepatic phosphorylase is activated in a series of reactions that requires ... In GSD type IV, the classic form, progressive liver cirrhosis rapidly leads to ... http://www.emedicine.com/derm/byname/glycogen-storage-diseases-types-i-vii.htm   www.emedicine.com - summary The biochemistry of fatty liver and kidney syndrome. Biotin-mediated ... Biotin-mediated restoration of hepatic gluconeogenesis in vitro and its ... The relationship of epinephrine and glucagon to liver phosphorylase. ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1163728   www.pubmedcentral.nih.gov - summary eMedicine - Glycogen Storage Disease, Type VI : Article by Wayne E Anderson Liver phosphorylase, which is found in the liver and red blood cells, is ... Liver function studies are indicated and may reveal evidence of hepatic injury. ... http://www.emedicine.com/med/topic912.htm   www.emedicine.com - summary The endocrine pancreas -- Endocrinology -- NCBI Bookshelf In the liver, insulin promotes glycogen synthesis by stimulating glycogen ... isoniazid-induced liver failure (with resultant loss of hepatic gluconeogenesis) ... http://www.ncbi.nlm.nih.gov/bookshelf/br.fcgi?book=endocrin&part=A59#A59   www.ncbi.nlm.nih.gov - summary Specific features of glycogen metabolism in the liver. Quantitation of hepatic glycogenolysis and gluconeogenesis in fasting humans ... Mechanism of activation of glycogen phosphorylase by fructose in the liver. ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1219837   www.pubmedcentral.nih.gov - summary Glucose cycle - Wikipedia, the free encyclopedia The glucose cycle (also known as the hepatic futile cycle) occurs primarily in ... A deficiency in glucose 6-phosphatase that disrupts the liver glucose cycle, can ... http://en.wikipedia.org/wiki/Glucose_cycle   en.wikipedia.org - summary eMedicine - Glycogen-Storage Disease Type III : Article Excerpt by ... ... involve the liver are hepatomegaly, hepatic dysfunction, and hypoglycemia. ... Phosphorylase first removes glucose moieties (see Image 2, in which the moieties ... http://www.emedicine.com/ped/byname/glycogen-storage-disease-type-iii.htm   www.emedicine.com - summary Angiogenic Factor Expression in Hepatic Cirrhosis ... of hepatic cirrhosis, associated the development of liver fibrosis with a ... by the absolute lack of expression of thymidine phosphorylase in fibroblasts, ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1847476   www.pubmedcentral.nih.gov - summary Sucrose intolerance - Wikipedia, the free encyclopedia ... NASH - Fatty liver - Peliosis hepatis - Hepatic veno-occlusive disease ... phosphorylase/GSD type VI, Hers', glycogen phosphorylase - GSD type I, von ... http://en.wikipedia.org/wiki/Sucrose_intolerance   en.wikipedia.org - summary The Rapid Changes of Hepatic Glycolytic Enzymes and Fructose-1, 6 ... The relationship of epinephrine and glucagon to liver phosphorylase. IV. ... and glucagon on the reactivation of phosphorylase in liver homogenates. J Biol Chem. ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=301436   www.pubmedcentral.nih.gov - summary Elevated Levels of Hepatocyte Nuclear Factor 3? in Mouse Hepatocytes ... ... and GGAGCAGGTGGTCATCACAATG), the glycogen phosphorylase probe (GP; ... While the T-77 livers displayed a twofold increase in hepatic mRNA levels of the ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=86435   www.pubmedcentral.nih.gov - summary ChemIDPlus/HSDB 75-35-4 Toxicity - National Toxicology Program ... phosphorylase-a and by monitoring the fluorescence of cell permeant quin2. ... were limited to the liver in which an increase in hepatic lesions was observed ... http://ntp.niehs.nih.gov/index.cfm?objectid=E882A8F6-BDB5-82F8-F4B5CC46B17EA568   ntp.niehs.nih.gov - summary eMedicine - Glycogen Storage Disease, Type IV : Article by Wayne E Anderson VI - Phosphorylase deficiency (Hers disease) ... hepatosplenomegaly, cirrhosis of the liver, and hepatic failure are major concerns. ... http://www.emedicine.com/med/topic910.htm   www.emedicine.com - summary Porphyria - Wikipedia, the free encyclopedia The hepatic porphyrias primarily affect the nervous system, resulting in ... Some liver diseases may cause porphyria even in the absence of genetic predisposition. ... http://en.wikipedia.org/wiki/Congenital_erythropoietic_porphyria   en.wikipedia.org - summary Calcium-mobilizing hormones and phorbol myristate acetate mediate ... ... angiotensin II, and glucagon on Ca2+ fluxes and phosphorylase activity in liver. ... the role of sodium in the alpha-adrenergic regulation of hepatic ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1148621   www.pubmedcentral.nih.gov - summary eMedicine - Purine Nucleoside Phosphorylase Deficiency : Article by ... The liver and spleen are usually normal in size but can be enlarged in patients ... or hepatic impairment (perform urinalyses and renal function tests during ... http://www.emedicine.com/ped/topic1957.htm   www.emedicine.com - summary Comparison of the effects of [leucine]enkephalin and angiotensin on ... The hepatic angiotensin II receptor. ... trisphosphate, Ca2+ mobilization, and phosphorylase activation in rat liver. Mol Pharmacol. ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1148759   www.pubmedcentral.nih.gov - summary Glycogenolysis - Wikipedia, the free encyclopedia Liver (hepatic) cells can consume the glucose-6-phosphate in glycolysis, or ... This results in more glucose units available to glycogen phosphorylase. ... http://en.wikipedia.org/wiki/Glycogenolysis   en.wikipedia.org - summary The influence of vasopressin and related peptides on glycogen ... ... abilities of seven vasopressin-like peptides to activate hepatic ... Glycogen phosphorylase, glucose output and vasoconstriction in the perfused rat liver. ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1186538   www.pubmedcentral.nih.gov - summary Henri G. Hers - Wikipedia, the free encyclopedia ... of hepatic phosphorylase, it is associated with an enlarged liver and mild hypoglycaemia [1] ... In 1966, he was awarded the Francqui Prize on Biological ... http://en.wikipedia.org/wiki/Henri_G._Hers   en.wikipedia.org - summary Acute troglitazone action in isolated perfused rat liver ... an allosteric effector of phosphorylase kinase from rabbit skeletal ... hepatic perfusion and bile secretory function in the isolated perfused rat liver. ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1565811   www.pubmedcentral.nih.gov - summary Executive Summary Atrazine - National Toxicology Program ... cell cultures and organotypic hepatic tissue cultures were dosed with ... Liver glycogen phosphorylase, adenylate cyclase and phosphodiesterase activities; ... http://ntp-server.niehs.nih.gov/ntpweb/index.cfm?objectid=73...   ntp-server.niehs.nih.gov - summary Altered liver acini induced in diabetic rats by portal vein islet ... ... on preneoplastic hepatic foci) in the altered liver acini surrounding the islet isografts. ... of glycogen phosphorylase, adenylate cyclase, glucose-6 ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1861511   www.pubmedcentral.nih.gov - summary eMedicine - Glucose-6-Phosphatase Deficiency : Article by Vasudevan A ... ... by single or multiple hepatic adenomas that appear in ... GSD type IX (liver phosphorylase kinase deficiency) WORKUP. Section 5 of 10. Authors and Editors ... http://www.emedicine.com/med/topic899.htm   www.emedicine.com - summary Activation of direct and indirect pathways of glycogen synthesis by ... Thus, PTG overexpression in liver enhances hepatic glucose clearance and storage ... but is instead allosterically regulated by binding to phosphorylase a (10) ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=289167   www.pubmedcentral.nih.gov - summary eMedicine - Glycogen Storage Disease, Type III : Article by Wayne E ... In many cases, the defect has systemic ... VI - Phosphorylase deficiency (Hers disease) ... In adults, it may progress to liver cirrhosis or hepatic adenomas. ... http://www.emedicine.com/med/topic909.htm   www.emedicine.com - summary Glycogen Storage Disease VIII Hepatic Phosphorylase Kinase Deficiency. Phosphorylase Kinase Deficiency of Liver ... for later use) are deposited in the liver, causing it to become enlarged ... http://children.webmd.com/glycogen-storage-disease-viii   children.webmd.com - summary ChemIDPlus/HSDB 59-89-2 Toxicity - National Toxicology Program The activity of N-nitrosomorpholine was determined in two in vivo rat liver ... phosphate dehydrogenase and glycogen phosphorylase, and in the glycogen content ... http://ntp.niehs.nih.gov/index.cfm?objectid=E8813085-BDB5-82F8-F94F8C488AB0CC63   ntp.niehs.nih.gov - summary Diurnal patterns of cardiac and hepatic pyruvate dehydrogenase complex ... ... refeeding on liver glycogen synthase and phosphorylase in obese and lean mice. ... Changes in the lipogenic response to feeding of liver, white adipose tissue and ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1134621   www.pubmedcentral.nih.gov - summary The stimulation of glycogenolysis in isolated hepatocytes by opioid ... ... of the cyclic AMP-independent glycogenolytic response in rat ... The hepatic angiotensin ... phosphorylase and of glycogen synthetase in isolated rat liver ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1147166   www.pubmedcentral.nih.gov - summary Effect of fructose 1-phosphate on the activation of liver glycogen synthase. ... D, Stalmans W. On the mechanism of hepatic glycogenolysis induced by anoxia ... Mechanism of activation of glycogen phosphorylase by fructose in the liver. ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1147414   www.pubmedcentral.nih.gov - summary Emedicine Search Results for hepatic GVHD Transfusion Requirements in Liver Transplantation. Transplantation. 06/24/2008 ... The... Purine Nucleoside Phosphorylase Deficiency. Pediatrics: General ... http://www.emedicine.com/cgi-bin/foxweb.exe/searchengine@/em...   www.emedicine.com - summary Thymidine phosphorylase, 2-deoxy-D-ribose and angiogenesis. ... studies of thymidine phosphorylase from mouse liver. Biochemistry. ... growth factor expression associated with hepatic metastasis in gastric carcinoma. ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1219653   www.pubmedcentral.nih.gov - summary Glycogen storage disease type I - Wikipedia, the free encyclopedia Several children with advanced hepatic complications have improved after liver transplantation. ... phosphorylase/GSD type VI, Hers', glycogen phosphorylase ... http://en.wikipedia.org/wiki/Glycogen_storage_disease_type_I   en.wikipedia.org - summary eMedicine - Glycogen Storage Disease, Type II : Article by Wayne E Anderson ... in the liver, which results in hepatomegaly and elevation of hepatic enzymes. ... the liver phosphorylase is not involved (only muscle phosphorylase) ... http://www.emedicine.com/med/topic908.htm   www.emedicine.com - summary MIM Gene map See the OMIM Morbid Map for a list of disease genes organized by ... Phosphorylase kinase, gamma 2 (testis/liver) 172471. Glycogenosis, hepatic, autosomal (3) ... http://www.ncbi.nlm.nih.gov/Omim/getmap.cgi?d7870   www.ncbi.nlm.nih.gov - summary Fine structural aspects of the mobilization of hepatic glycogen. II ... ELECTRON MICROSCOPY OF THE CYTOPLASM OF PARENCHYMAL LIVER CELLS IN ALPHA ... of liver uridine diphosphate glucose-glycogen transferase and phosphorylase by ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=2047463   www.pubmedcentral.nih.gov - summary Mosaic analysis of insulin receptor function ... (Gys1), glycogen phosphorylase (Pygl), phosphofructokinase, liver (Pfkl), Foxo1, ... As in ?80 mice, hepatic glycogen content was severely decreased. ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=310748   www.pubmedcentral.nih.gov - summary eMedicine - Glycogen Storage Disease, Type V : Article by Wayne E Anderson ... an expected finding because liver phosphorylase is not involved. ... Hepatic failure occurs in some patients with GSDs. Liver function studies are indicated. ... http://www.emedicine.com/med/topic911.htm   www.emedicine.com - summary The glucose paradox. Is glucose a substrate for liver metabolism? ... phosphorylase and of glycogen synthetase in isolated rat liver preparations. ... Arterial-hepatic vein glucose differences in normal and diabetic man after a ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=425376   www.pubmedcentral.nih.gov - summary report.nih.gov/award/trends/AggData/MedicalSchools_2005.xls ... in the Brain*K23RR017404-04*Samuel, Varman T3Mechanism of Fat Induced Hepatic ... T cells*R03DK066287-02-NTPDase2 expression and function in the liver*R01GM064625 ... http://report.nih.gov/award/trends/AggData/MedicalSchools_2005.xls   report.nih.gov - summary show more 1  2

Chat with eNurse Kim about 'hepatic phosphorylase in the liver' or something else! quick facts related diagnosis category genetic or congenital metabolic