what is 'anti-m2, anti-m4, anti-m8, and anti-m9 antibodies'? Definition for anti-M2, anti-M4, anti-M8, and anti-M9 antibodies anti-M2, anti-M4, anti-M8, and anti-M9 antibodies is a medical procedure used for such diagnoses as: primary biliary cirrhosis. related diagnosis search results for 'anti-m2, anti-m4, anti-m8, and anti-m9 antibodies' 1 - 1 of 1 diagnosis primary biliary cirrhosis type of liver cirrhosis anti-M2, anti-M4, anti-M8, and anti-M9 antibodies and primary biliary cirrhosis related procedure search results for 'anti-m2, anti-m4, anti-m8, and anti-m9 antibodies'/associated diagnoses 1 - 5 of 30 procedures Abdominal CAT Scan anti-M2, anti-M4, anti-M8, and anti-M9 antibodies and Abdominal CAT Scan Abdominal MRI MRI of abdominal contents anti-M2, anti-M4, anti-M8, and anti-M9 antibodies and Abdominal MRI Abdominal ultrasonography Ultrasound of abdominal contents anti-M2, anti-M4, anti-M8, and anti-M9 antibodies and Abdominal ultrasonography Anti-Ro (SS-A) antibodies antibodies against certain collagen vascular diseases anti-M2, anti-M4, anti-M8, and anti-M9 antibodies and Anti-Ro (SS-A) antibodies Anti-single stranded DNA antibodies (anti-ssDNA) anti-M2, anti-M4, anti-M8, and anti-M9 antibodies and Anti-single stranded DNA antibodies (anti-ssDNA) Anticentromere antibodies antibodies in certain collagen vascular diseases anti-M2, anti-M4, anti-M8, and anti-M9 antibodies and Anticentromere antibodies Antimitochondrial antibody (AMA) anti-M2, anti-M4, anti-M8, and anti-M9 antibodies and Antimitochondrial antibody (AMA) Antinuclear Antibody (ANA) Antinuclear antibody blood test used to screen for autoimmune disorders anti-M2, anti-M4, anti-M8, and anti-M9 antibodies and Antinuclear Antibody (ANA) Biopsy liver anti-M2, anti-M4, anti-M8, and anti-M9 antibodies and Biopsy liver Blood, Platelet Count Platelet Count anti-M2, anti-M4, anti-M8, and anti-M9 antibodies and Blood, Platelet Count Complete Blood Count anti-M2, anti-M4, anti-M8, and anti-M9 antibodies and Complete Blood Count Endoscopy anti-M2, anti-M4, anti-M8, and anti-M9 antibodies and Endoscopy Endoscopy, Upper Gastrointestinal Endoscopy anti-M2, anti-M4, anti-M8, and anti-M9 antibodies and Endoscopy, Upper Gastrointestinal Erythrocyte Sedimentation Rate (ESR) anti-M2, anti-M4, anti-M8, and anti-M9 antibodies and Erythrocyte Sedimentation Rate (ESR) Exercise programs anti-M2, anti-M4, anti-M8, and anti-M9 antibodies and Exercise programs Liver Function Tests elevated liver enzymes anti-M2, anti-M4, anti-M8, and anti-M9 antibodies and Liver Function Tests Liver Transplant Replacing diseased liver by healthy one anti-M2, anti-M4, anti-M8, and anti-M9 antibodies and Liver Transplant Plasmapheresis Hemapheresis anti-M2, anti-M4, anti-M8, and anti-M9 antibodies and Plasmapheresis Prothrombin Time (PT) anti-M2, anti-M4, anti-M8, and anti-M9 antibodies and Prothrombin Time (PT) Serum Albumin type of protein in human plasma anti-M2, anti-M4, anti-M8, and anti-M9 antibodies and Serum Albumin for more please login, login is free (click to login) related medication search results for 'anti-m2, anti-m4, anti-m8, and anti-m9 antibodies'/associated diagnoses 1 - 5 of 30 drugs cholestyramine anti-M2, anti-M4, anti-M8, and anti-M9 antibodies and cholestyramine colchicine anti-M2, anti-M4, anti-M8, and anti-M9 antibodies and colchicine colestipol anti-M2, anti-M4, anti-M8, and anti-M9 antibodies and colestipol cyclosporine anti-M2, anti-M4, anti-M8, and anti-M9 antibodies and cyclosporine dronabinol anti-M2, anti-M4, anti-M8, and anti-M9 antibodies and dronabinol hydroxyzine anti-M2, anti-M4, anti-M8, and anti-M9 antibodies and hydroxyzine methotrexate anti-M2, anti-M4, anti-M8, and anti-M9 antibodies and methotrexate prednisolone anti-M2, anti-M4, anti-M8, and anti-M9 antibodies and prednisolone rifampin anti-M2, anti-M4, anti-M8, and anti-M9 antibodies and rifampin ursodeoxycholic acid (udca) anti-M2, anti-M4, anti-M8, and anti-M9 antibodies and ursodeoxycholic acid (udca) for more please login, login is free (click to login) The following are types of physicians relevant for 'anti-M2, anti-M4, anti-M8, and anti-M9 antibodies'. related types of physicians 'family practitioner, gastroenterologist, internist' show local physicians postal code Find Local stars represent relevance to topic not rating more The results are computer generated suggestions to help you find a physician. MEDgle does not recommend any particular type of physician or claim to be complete or accurate in the providers and specialties suggested. web search results for 'anti-m2, anti-m4, anti-m8, and anti-m9 antibodies'? Results 1 - 50 - anti-M2, anti-M4, anti-M8, and anti-M9 antibodies eMedicine - Primary Biliary Cirrhosis : Article by Nikolaos T Pyrsopoulos These antibodies target different components, mainly enzymes, in the mitochondria. The presence of anti-M2, anti-M4, anti-M8, and anti-M9 has been associated with ... http://www.emedicine.com/med/topic223.htm   www.emedicine.com - summary Antimitochondrial antibody profiles in patients wi...[J Hepatol. 1994 ... ... M2, M4, M8, and M9 in ELISA and the complement fixation test: A: anti-M9 ... antibody/anti-M2 positive, and one patient had only antibodies to nuclear ... http://www.ncbi.nlm.nih.gov/pubmed/8006398   www.ncbi.nlm.nih.gov - summary SH2-B and APS Are Multimeric Adapters That Augment TrkA Signaling Secondary antibodies were either anti-mouse or anti-rabbit Ig-horseradish ... in HEK293T cells, mutants M4, M5, and M8, which lack the amino-terminal ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?&artid=86707   www.pubmedcentral.nih.gov - summary Selective Gene Expression of Latent Murine Gammaherpesvirus 68 in B ... ... anti-CD11c, anti-CD21, anti-CD23, anti-B220 (CD45R), and peanut ... B-cell subsets analyzed include M1, M2, M3, M4, K3, M8, M9, and 72. Given that B ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=164786   www.pubmedcentral.nih.gov - summary BSI Modifier Codes M4. PERIOVULATORY. M5. T1-EXTRA. M6. T2-EXTRA. M7. T3-EXTRA. M8. T4-EXTRA. M9. T0 ... VIRAL ANTIBODIES. TK. HERPES SIMPLEX VIRUS. TKN. TOKEN DATE (YYYYMMDD) ... http://silk.nih.gov/PUBLIC/UAT1PMI.@WWW.BMOD.HTM   silk.nih.gov - summary Multiple Domains of Fission Yeast Cdc19p (MCM2) Are Required for Its ... ... HRP-conjugated anti-rabbit or anti-mouse secondary antibodies and ECL (Amersham, Arlington, IL) ... in M1, M2, M3, M4, and M5 immunoprecipitates ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=25423   www.pubmedcentral.nih.gov - summary Axin stimulates p53 functions by activation of HIPK2 kinase through ... ... Axin, Axin-M3, Axin-M4, Axin-M8, or Axin-M9 into 293 cells (Figure 7B) ... Antibodies used include anti-HA (F-7), anti-Myc (9E10), anti-HIPK2 (C-15), DO-1 ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=533058   www.pubmedcentral.nih.gov - summary A Zinc Finger Transcription Factor, ?A-Crystallin Binding Protein 1, Is a Negative Regulator of the Chondrocyte-... ... M1, M3, and M4 inhibited the binding, whereas M2 failed to block ... to the labeled WT, and anti-Sox9 antibodies supershifted the Sox9 enhancer ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pub...   www.pubmedcentral.nih.gov - summary The STE20 Kinase HGK Is Broadly Expressed in Human Tumor Cells and Can ... ... followed by Western blotting with anti-Myc tag antibodies 9E10 and anti-STAT-3. ... spliced modules, of which the M8 but not the M9 module is conserved in CNH ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pub...   www.pubmedcentral.nih.gov - summary Gene Therapy: Safe and efficient transduction of the liver after ... ... after liver-targeted delivery (mean of 68 c/dg in M1-sc and M2-sc) of the ... macaques (M8-sc and M9-sc) with modest titers of anti-AAV8 antibodies (mean of ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pub...   www.pubmedcentral.nih.gov - summary Mex67p of Schizosaccharomyces pombe Interacts with Rae1p in Mediating ... ... using polyclonal anti-Rae1p and monoclonal anti-GST antibodies followed by the ... LR473,474 AA (M1), LI481,482 AA (M2), PG484,485 AA (M4), II492,493 AA ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?&artid=86506   www.pubmedcentral.nih.gov - summary Translational and Structural Requirements of the Early Nodulin Gene ... Secondary anti-rabbit immunoglobulin G antibodies coupled to alkaline ... other reading frames within sORF II (M7 and M8) or after sORF II (e.g., M9) also ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?&artid=88808   www.pubmedcentral.nih.gov - summary Endoplasmic Reticulum Quality Control of Oligomeric Membrane Proteins ... ... by using polyclonal anti-? or anti-? antibodies (Ackermann and Geering, 1990 ) ... with the efficient SA or ST properties of M1 and M3 or M2 and M4, respectively. ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=14874   www.pubmedcentral.nih.gov - summary The BRCT domain of mammalian Pes1 is crucial for nucleolar localization ... In particular, M2, M4 and M9 are poorly expressed despite identical induction ... However, M6 and M8 fully restored the synthesis of the mature 28S rRNA (Figure ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1807956   www.pubmedcentral.nih.gov - summary Shared Pathways of I?B Kinase-Induced SCF?TrCP-Mediated Ubiquitination ... Anti-Flag tag antibody M2 or M5 (Sigma) and anti-T7 tag antibody (Novagen) were ... one of these residues (in M4, M9, and M8) was also severely impaired, as were ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=99557   www.pubmedcentral.nih.gov - summary Molecular Characterization of Thermoinduced Immunogenic Proteins Q1p42 ... ... of Qlp42-specific antibodies were high in six mares (M1, M2, M3, M4, M6, and M11), low in two mares (M7 and M9), and undetectable in three mares (M5, M8, and M10) ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pub...   www.pubmedcentral.nih.gov - summary Induction of Plasmodium falciparum Transmission-Blocking Antibodies in ... Group 1 (M1, M2, M3, and M4) received 0.5 mg of VR1020 encoding Pfs25 (VR1020/25) ... Additionally, IgG2 and IgG4 isotype anti-Pfs25 antibodies also became detectable ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pub...   www.pubmedcentral.nih.gov - summary Kaposi's Sarcoma-Associated Herpesvirus Lytic Switch Protein Stimulates ... ... to RBP-Jk in vitro are those that are not transactivated by Rta (m2, m3, and m8) ... assembles on the m4 DNA, but not on the m9 DNA (compare lanes 5 ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pub...   www.pubmedcentral.nih.gov - summary Androgen-repressed phenotype in human prostate cancer ... M5 = t(5p;?); M6 = t(7q;8p); M7 = del(8p); M8 = t(12q;?); M9 = inv ... M1, M4, M8, M10, and M11 were present in more than one copy each, whereas M2, M3, ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=8986779   www.pubmedcentral.nih.gov - summary Regulatory Serine Residues Mediate Phosphorylation-dependent and ... ... membranes and processed by Western blotting using anti-FLAG (M2) antibodies. ... individually or taken together (mutants M8, M9, and M10), did not render the ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?&artid=1224706   www.pubmedcentral.nih.gov - summary Characterization of a new mitochondrial antigen-antibody system (M9 ... ... fraction was devoid of the previously described M1-M8 antigens except for M4. ... Anti-M9 antibodies were detected in 37% of 156 anti-M2 positive as well as in 82 ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?&artid=1541717   www.pubmedcentral.nih.gov - summary ZBP-89 represses vimentin gene transcription by interacting with the ... ... and mutants M1, M3, M4, M7, M8, M9 and M10 compete with the 32P-labeled PS for ... However, mutants M2 (lane 5), M5 (lane 9) and M6 (lane 10) are unable to ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?&artid=156715   www.pubmedcentral.nih.gov - summary Human Immunodeficiency Virus Type 1 Protease Regulation of Tat Activity ... In contrast, the anti-GFP antibody detected only full-length M8 and one smaller ... transcription defect was observed in M9, while M4 and M10 showed an intermediate ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?&artid=224567   www.pubmedcentral.nih.gov - summary A Krüppel-Associated Box-Zinc Finger Protein, NT2, Represses Cell-Type ... ... NT2 and were used to demonstrate specific reactivity of the anti-NT2 antibodies. ... 3?; M8, 5?-CAGGGAGGGTGGAGAGCGGCTGCT-3?; M9, 5?-CAGGGAGGAGTTAGAGCGGCTGCT ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=133841   www.pubmedcentral.nih.gov - summary Role for Upf2p Phosphorylation in Saccharomyces cerevisiae Nonsense ... ... the same Western blot with anti-Upf1p and anti-Pgk1p antibodies, respectively. ... that only the mutants deficient in Hrp1p binding (m5, m8, and m9) had impaired ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1447418   www.pubmedcentral.nih.gov - summary Calmodulin Interacts with and Regulates the RNA-Binding Activity of an ... ... that for the wild-type and m4 proteins, comparable with that of the m9 protein. ... Antibodies, Coimmunoprecipitation, and Immunoblotting ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1459842   www.pubmedcentral.nih.gov - summary Ca2+, CREB and Krüppel: A novel KLF7-binding element conserved in mouse ... Introduction of the TCaRE3 mutation, M4, inhibited both Ca2+-stimulated and cAMP ... M8: GTCTGTTTGTCCTCAGATCTGAGGTGCGCACC; M9: TGTTTGTCCTCAGCCGGGAGGTGCGCACCGAT; TBP ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=2042965   www.pubmedcentral.nih.gov - summary HNS, a nuclear-cytoplasmic shuttling sequence in HuR ... antibodies in 1% normal goat serum/PBS at room temperature for 1 hr. The anti ... terminus of PK-M10, as in -M8, -M9, and -M11, result in fusion-protein ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=28...   www.pubmedcentral.nih.gov - summary Phospholamban domain IB forms an interaction site with the loop between ... ... M6, and M8, but M4 and M6 helices unwind near their centers to accommodate the ... interacts with M6 (2), so that M2 and M9 are also candidate interaction sites. ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=56915   www.pubmedcentral.nih.gov - summary show more 1

Chat with eNurse Kim about 'anti-M2, anti-M4, anti-M8, and anti-M9 antibodies' or something else! quick facts related diagnosis category liver gallbladder and bile ducts