reduced results from

147 billion

123 million

373140

378

to ~28 options

options split into images, definition, symptoms, related diagnoses, diagnostic tests, therapies, and medications

what is 'rickettsia dna amplified probe'? Definition for Rickettsia DNA Amplified Probe Rickettsia DNA Amplified Probe is a medical procedure used for such diagnoses as: epidemic typhus, murine typhus and scrub typhus. related diagnosis for 'rickettsia dna amplified probe' 1 - 3 of 3 diagnosis epidemic typhus louse borne rickettsial diasease Rickettsia DNA Amplified Probe and epidemic typhus murine typhus infectious disease transmitted by fleas Rickettsia DNA Amplified Probe and murine typhus scrub typhus flu like illness with bleeding Rickettsia DNA Amplified Probe and scrub typhus related procedure for 'rickettsia dna amplified probe'/associated diagnoses 1 - 5 of 18 procedures 4-fold increase in serum antibody titers Rickettsia DNA Amplified Probe and 4-fold increase in serum antibody titers Biopsy Rickettsia DNA Amplified Probe and Biopsy Biopsy skin Rickettsia DNA Amplified Probe and Biopsy skin ELISA (Enzyme-linked immunosorbent assay) Rickettsia DNA Amplified Probe and ELISA (Enzyme-linked immunosorbent assay) Polymerase Chain Reaction (PCR) Rickettsia DNA Amplified Probe and Polymerase Chain Reaction (PCR) Rickettsia Typhi serology Rickettsia DNA Amplified Probe and Rickettsia Typhi serology Serum Albumin type of protein in human plasma Rickettsia DNA Amplified Probe and Serum Albumin immunoflorescence assay (IFA) Rickettsia DNA Amplified Probe and immunoflorescence assay (IFA) BUN Rickettsia DNA Amplified Probe and BUN Complete Blood Count Rickettsia DNA Amplified Probe and Complete Blood Count Complete metabolic panel Rickettsia DNA Amplified Probe and Complete metabolic panel Febrile Agglutinins Panel Rickettsia DNA Amplified Probe and Febrile Agglutinins Panel Indirect fluorescent antibody Rickettsia DNA Amplified Probe and Indirect fluorescent antibody Rickettsial antibodies Rickettsia DNA Amplified Probe and Rickettsial antibodies Serum Creatinine Rickettsia DNA Amplified Probe and Serum Creatinine Total serum protein Rickettsia DNA Amplified Probe and Total serum protein indirect immunoperoxidase Rickettsia DNA Amplified Probe and indirect immunoperoxidase serum electrolytes Rickettsia DNA Amplified Probe and serum electrolytes for more please login, login is free (click to login) related medication for 'rickettsia dna amplified probe'/associated diagnoses 1 - 5 of 18 drugs chloramphenicol Rickettsia DNA Amplified Probe and chloramphenicol doxycycline Rickettsia DNA Amplified Probe and doxycycline tetracycline Rickettsia DNA Amplified Probe and tetracycline azithromycin Rickettsia DNA Amplified Probe and azithromycin ciprofloxacin Rickettsia DNA Amplified Probe and ciprofloxacin rifampin Rickettsia DNA Amplified Probe and rifampin tetracyclines Rickettsia DNA Amplified Probe and tetracyclines for more please login, login is free (click to login) The following are types of physicians relevant for 'Rickettsia DNA Amplified Probe'. related types of physicians 'family practitioner, infectious disease specialist, internist' show local physicians postal code Find Local stars represent relevance to topic not rating more The results are computer generated suggestions to help you find a physician. MEDgle does not recommend any particular type of physician or claim to be complete or accurate in the providers and specialties suggested. web search results for 'rickettsia dna amplified probe'? Results 1 - 50 - Rickettsia DNA Amplified Probe Probe directed at a segment of Rickettsia rickettsii rRNA amplified ... Probe directed at a segment of Rickettsia rickettsii rRNA amplified with ... Rapid identification of Mycobacterium avium complex in culture using DNA probes. ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=267110   www.pubmedcentral.nih.gov - summary High-Density Microarray of Small-Subunit Ribosomal DNA Probes ... Diseases, Frederick, Md. DNA from Rickettsia prowazekii and Coxiella burnetii ... Performance of the Gen-Probe AMPLIFIED Chlamydia Trachomatis Assay in detecting ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pub...   www.pubmedcentral.nih.gov - summary "marmionii" Strain of Rickettsia honei | CDC EID Phylogenetic analysis of DNA sequences was performed with DNADIST and NEIGHBOR ... The Sca4 antigen gene (sca4) was amplified by using the primer pairs D1f and ... http://www.cdc.gov/eid/content/13/4/566.htm   www.cdc.gov - summary Detection of Rochalimaea henselae DNA in specimens from cat scratch ... ... fragment of DNA from the rickettsia-like organisms Rochalimaea henselae and R. quintana. ... of R. henselae were amplified with the PCR primers, and ... http://www.ncbi.nlm.nih.gov/pubmed/8027347   www.ncbi.nlm.nih.gov - summary Rickettsia helvetica in Ticks | CDC EID Primer and probe sequences are shown in Table 1. Borrelia DNA was investigated ... The amplified ompA sequences were 100% identical to the corresponding ompA gene ... http://www.cdc.gov/eid/content/15/1/98.htm   www.cdc.gov - summary Propagation of Arthropod-Borne Rickettsia spp. in Two Mosquito Cell Lines ... on all extracted DNA by using Rickettsia genomic DNA as a positive control ... The Rickettsia-specific FISH probe was conjugated with a 5?-end 6 ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=2075076   www.pubmedcentral.nih.gov - summary Evaluation of a PCR Assay for Quantitation of Rickettsia rickettsii and ... However, although both probe- and SYBR Green-based assays were mentioned, Rolain ... DNA samples from 11 spotted fever group rickettsiae were amplified, with ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=308968   www.pubmedcentral.nih.gov - summary Scrub Typhus in Himalayas | CDC EID The sizes of the PCR-amplified products were determined by comparison with a ... Sequencing was performed on an ABI PRISM 310 DNA Sequencer (Applied Biosystems) ... http://www.cdc.gov/NCIDOD/EID/vol12no10/05-1697.htm   www.cdc.gov - summary 1987160 1991 02 20 1991 02 20 2008 11 20 0021-9193 173 2 1991 Jan J ... Anaplasmas are related to the genera Rickettsia and Ehrlichia. ... 2985120R 0 DNA, Bacterial 0 DNA, Ribosomal 0 Oligonucleotide Probes 0 RNA, ... http://www.ncbi.nlm.nih.gov/pubmed/1987160   www.ncbi.nlm.nih.gov - summary Transposon Mutagenesis of the Obligate Intracellular Pathogen ... Genetic analysis of Rickettsia prowazekii has been hindered by the lack of ... was increased to 60°C. Amplified DNA was separated by gel electrophoresis, ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=404435   www.pubmedcentral.nih.gov - summary Rickettsia Symbiont in the Pea Aphid Acyrthosiphon pisum: Novel ... ... of the eubacterial 16S rRNA gene was amplified by PCR from the DNA of the ... of the strain OY, strong signals of Rickettsia-specific probe were found in two ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pub...   www.pubmedcentral.nih.gov - summary Tickborne Infections in Denmark | CDC EID All were PCR negative for Rickettsia helvetica. ... Total DNA was extracted from blood samples by using a QIAamp Blood kit (Qiagen, ... http://www.cdc.gov/ncidod/EID/vol11no07/04-1265.htm   www.cdc.gov - summary Transformation of Rickettsia prowazekii to Rifampin Resistance Probes for use in Southern hybridizations (25) were 32P labeled using the ... primers, a 2.1-kb fragment was amplified by using template DNA obtained from ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=9555894   www.pubmedcentral.nih.gov - summary Differential Expression of Genes in Uninfected and Rickettsia-Infected ... Probe hybridization and subsequent analysis were carried out as ... fragment length polymorphism of PCR-amplified DNA of the gene encoding the protein rOmpA. ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=219596   www.pubmedcentral.nih.gov - summary Detection of Rickettsia japonica in Haemaphysalis longicornis ticks by ... ... T. Nucleotide sequence of polymerase chain reaction product amplified from Rickettsia japonica DNA using Rickettsia rickettsii 190-kilodalton surface ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=228049   www.pubmedcentral.nih.gov - summary Comparative Genomics of Rickettsia prowazekii Madrid E and Breinl Strains ... of an R. prowazekii DNA microarray with 834 PCR-amplified gene products from ... The labeled DNA probe was hybridized to the membrane, and signal was detected ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=305770   www.pubmedcentral.nih.gov - summary CDC - Parachlamydiaceae as Rare Agents of Pneumonia All but one (Rickettsia montana) was negative, as were 64 sterile water controls. ... in Rickettsiae, Chlamydiae, and plant plastids, and uses a specific DNA probe. ... http://www.cdc.gov/ncidod/EID/vol9no6/02-0613.htm   www.cdc.gov - summary Characterization of Spotted Fever Group Rickettsiae in Flea and Tick ... ... length polymorphism of PCR-amplified DNA of the gene encoding the ... Detection of Rickettsia rickettsii DNA in clinical specimens by using polymerase ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=525230   www.pubmedcentral.nih.gov - summary Note: Genetic Classification of "Rickettsia heilongjiangii" and ... ... DNA, gltA, and ompA (apart from the tandem repeat units) genes were amplified by ... labeled cloned DNA probes (1, 3, 17, 21, 31, 32, 34), are not widely ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=87418   www.pubmedcentral.nih.gov - summary Real-Time PCR Assay To Detect Smallpox Virus ... virus genomic DNA (1 fg/?l to 1 ng/?l) were tested with TaqMan probe VARJ7R3P on ... The Rickettsia, varicella virus, and herpesvirus DNAs were provided by ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pub...   www.pubmedcentral.nih.gov - summary Analysis of Fluorescent Protein Expression in Transformants of ... ... terminator were PCR amplified from Hlp#2 DNA and cloned into vector pGEM ... The same probe hybridized to KpnI-digested Rmona601 DNA, cleaving the pMOD601 ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pub...   www.pubmedcentral.nih.gov - summary Identification and Localization of a Rickettsia sp. in Bemisia tabaci ... ... electrophoresis, and the remaining 45 ?l containing the amplified DNA fragments ... no-probe control, RNase-digested control, and Rickettsia-free whiteflies. ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pub...   www.pubmedcentral.nih.gov - summary Genomics and Bacterial Pathogenesis Determining the DNA sequence of a complete genome is a major ... be amplified by PCR. ... The genome sequence of Rickettsia prowazekii and the origin of ... http://www.cdc.gov/ncidod/eid/vol6no5/weinstock.htm   www.cdc.gov - summary Rickettsia monacensis sp. nov., a Spotted Fever Group Rickettsia, from ... Texas red phalloidin (Molecular Probes, Eugene, Oreg. ... fragment length polymorphism of PCR-amplified DNA of the gene encoding the protein rOmpA. ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=124077   www.pubmedcentral.nih.gov - summary Quantitative Multiprobe PCR Assay for Simultaneous Detection and ... The probes were designed to anneal to opposite strands of the template DNA. ... amplified product to hybridization using different sets of specific probes (10) ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=130696   www.pubmedcentral.nih.gov - summary Molecular Method for Bartonella Species Identification in Clinical and ... ... Orientia, Rickettsia, and Treponema hybridized with the probes designed for ... As expected, in all the samples the IAC was amplified, and the sensitivity for ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=2238138   www.pubmedcentral.nih.gov - summary GEO Accession viewer ... Rickettsia conorii 0.7 k. Technology type. spotted DNA/cDNA ... The amplified DNA fragments were thenDC-2 robot (Bio-Rad, Marnes-la-Coquette, France) ... http://www.ncbi.nlm.nih.gov/projects/geo/query/acc.cgi?acc=GPL3961   www.ncbi.nlm.nih.gov - summary Differentiation among spotted fever group rickettsiae species by ... ... by analysis of restriction fragment length polymorphism of PCR-amplified DNA. ... Detection of Rickettsia rickettsii in saliva, hemolymph and triturated tissues ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=263128   www.pubmedcentral.nih.gov - summary Sequence and Expression Analysis of the ompA Gene of Rickettsia ... ... analysis included PCR-amplified ompA sequences from genomic DNA of R. peacockii ... with rhodamine-conjugated phalloidin (Molecular Probes, Eugene, Oreg. ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=525201   www.pubmedcentral.nih.gov - summary Tick-Borne Rickettsial Pathogens in Ticks and Small Mammals in Korea ... described, using a set of primers with a probe that amplified ... Specific amplification of Rickettsia japonica DNA from clinical specimens by PCR. ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pub...   www.pubmedcentral.nih.gov - summary Transcriptional Analysis of Rickettsia prowazekii Invasion Gene Homolog ... ... 100 nM fluorescent probe, and 1 U of Platinum Taq DNA polymerase (Invitrogen) ... was amplified from R. prowazekii-infected Vero cell cDNA and the genomic DNA of ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=130406   www.pubmedcentral.nih.gov - summary Genomic and proteinic characterization of strain S, a rickettsia ... ... polymorphism of PCR-amplified DNA. J Clin Microbiol. ... Regnery R. Use of DNA probes for differentiation of spotted fever group and other rickettsiae. ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=228566   www.pubmedcentral.nih.gov - summary RickA Expression Is Not Sufficient to Promote Actin-Based Motility of ... The cultivation of rickettsial isolates genetically identical to Rickettsia sp. ... DNA as the template, we successfully amplified a PCR fragment with a nucleotide ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=2440523   www.pubmedcentral.nih.gov - summary Amplification of bacterial 16S ribosomal DNA with polymerase chain reaction. Direct sequencing of enzymatically amplified human genomic DNA. ... Probe directed at a segment of Rickettsia rickettsii rRNA amplified with ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=268083   www.pubmedcentral.nih.gov - summary Multiplex Real-Time PCR for Detection of Anaplasma phagocytophilum and ... ... with DNA extracted from the following organisms: Rickettsia rickettsii Sheila ... Oligonucleotide probe and primer sequences were designed to be specific for B. ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=446246   www.pubmedcentral.nih.gov - summary Quantitative Real-Time PCR for Detection of Members of the Ehrlichia ... ... 145f (5?-CCATTTCTAGTGGCTATCCCATACTAC-3?) amplified a 106-bp fragment of ... activity of Taq DNA polymerase to digest the TaqMan probe, which hybridizes to ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=84766   www.pubmedcentral.nih.gov - summary Molecular Cloning and Characterization of the 120-Kilodalton Protein ... The E. canis probe was amplified by PCR with primers 515f (GAA ATC CAT CAA GTG ... No DNA was amplified by using primers derived from the coding region of the E. ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=88726   www.pubmedcentral.nih.gov - summary Rickettsia conorii Transcriptional Response within Inoculation Eschar ... of cDNA were amplified using the GenomiPhi DNA amplification kit (Amersham ... Probe PCR kit (Qiagen) or SybrGreen DNA Fast Start kit (Roche Diagnostics, Basel, ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pub...   www.pubmedcentral.nih.gov - summary Rickettsioses as paradigms of new or emerging infectious diseases. ... fragment length polymorphism of PCR-amplified DNA of the gene encoding the protein rOmpA. ... Rickettsia japonica DNA using Rickettsia rickettsii 190 ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=9336669   www.pubmedcentral.nih.gov - summary Rickettsia helvetica Rickettsia spp. In summary, R. helvetica DNA was detected in 10 of ... Primers and probe. Sequence (5 3 ) Rickettsia helvetica. ompB_forward GATTTCGACGGTAAAATTACC ... http://www.cdc.gov/eid/content/15/1/pdfs/98.pdf   www.cdc.gov - summary Expression of Anaplasma marginale Major Surface Protein 2 Variants ... A. marginale is an intraerythrocytic rickettsia that infects cattle and can ... amount of DNA extracted from persistently infected cattle was amplified in the ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=108034   www.pubmedcentral.nih.gov - summary Development and evaluation of PCR assay for detection of low levels of ... A cloned DNA probe for Cowdria ruminantium hybridizes with eight heartwater ... (Rickettsiales) determined by analysis of amplified 16S ribosomal DNA sequences. ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=227901   www.pubmedcentral.nih.gov - summary Rickettsia prowazekii and Real-time Polymerase Chain Reaction µmol/µL) probe, 5 µL distilled water, and 2 µL extracted. DNA. ... amplified from blood of experimentally infected mice. This ... http://www.cdc.gov/ncidod/eid/vol12no03/pdfs/05-0888.pdf   www.cdc.gov - summary Multi-pathogens sequence containing plasmids as positive controls for ... We also designed primers and probes to detect DNA of these agents. ... Moreover, amplified DNA from the control can be differentiated from the natural ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=425577   www.pubmedcentral.nih.gov - summary Body Lice as Tools for Diagnosis and Surveillance of Reemerging Diseases Sequencing of DNA fragments amplified by PCR confirmed the identities of the expected bacteria. ... Amblyomma ticks not detected by DNA probe. J Clin Microbiol. ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=84482   www.pubmedcentral.nih.gov - summary Comparison of Ehrlichia chaffeensis Recombinant Proteins for Serologic ... ... protein gene probe was a 2,195-bp DNA fragment which was PCR amplified from E. ... J E. Human infection with Ehrlichia canis, a leukocytic rickettsia. ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=85285   www.pubmedcentral.nih.gov - summary Efficacy of Doxycycline, Azithromycin, or Trovafloxacin for Treatment ... Rickettsial DNA was amplified from 21 of 24 EDTA-blood samples from untreated ... a segment of Rickettsia rickettsii rRNA amplified with polymerase chain reaction. ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=89211   www.pubmedcentral.nih.gov - summary Excision of misincorporated ribonucleotides in DNA by RNase H (type 2 ... ... (Fig. 1, probe 4) were obtained from Integrated DNA Technologies (Coralville, IA) ... ATC by using a previously amplified ampicillin-resistance cassette amp from ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pub...   www.pubmedcentral.nih.gov - summary Molecular and Functional Analysis of the lepB Gene, Encoding a Type I ... The genus Rickettsia comprises several intracellular pathogens, some of which ... lepB gene was PCR amplified from R. rickettsii DNA by using the forward primer ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pub...   www.pubmedcentral.nih.gov - summary Transcriptional Regulation of Endothelial Cell Tissue Factor Expression ... ... well as expression of other rickettsia-induced proteins, have remained elusive. ... The TF probe was prepared by using the EcoRI-HindIII fragment corresponding to ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=108017   www.pubmedcentral.nih.gov - summary show more 1  2

Chat with eNurse Kim about 'Rickettsia DNA Amplified Probe' or something else! quick facts related diagnosis category infectious diseases