what is 'g-csf'? Definition for g-csf g-csf is medication used for such diagnoses as: chronic lymphocytic leukemia, Felty Syndrome. search results for diagnoses treated with 'g-csf' 1 - 2 of 2 diagnosis chronic lymphocytic leukemia cancer of white blood cells web search for: g-csf and chronic lymphocytic leukemia Felty Syndrome complication of rheumatoid arthritis web search for: g-csf and Felty Syndrome search results for related procedures when taking 'g-csf' 1 - 5 of 9 procedures Abdominal CAT Scan web search for: g-csf and Abdominal CAT Scan Abdominal ultrasonography Ultrasound of abdominal contents web search for: g-csf and Abdominal ultrasonography Biopsy bone marrow web search for: g-csf and Biopsy bone marrow Bone Marrow Aspiration web search for: g-csf and Bone Marrow Aspiration CT scan web search for: g-csf and CT scan Complete Blood Count web search for: g-csf and Complete Blood Count Splenectomy web search for: g-csf and Splenectomy serum immunoglobulins web search for: g-csf and serum immunoglobulins ultrasound spleen web search for: g-csf and ultrasound spleen for more please login, login is free (click to login) related medication search results for 'g-csf' 1 - 4 of 4 drugs alemtuzumab web search for: g-csf and alemtuzumab chlorambucil web search for: g-csf and chlorambucil cyclophosphamide(cytoxan) web search for: g-csf and cyclophosphamide(cytoxan) prednisone web search for: g-csf and prednisone The following are types of physicians relevant for 'g-csf'. related types of physicians 'family practitioner, internist' show local physicians postal code Find Local stars represent relevance to topic not rating more The results are computer generated suggestions to help you find a physician. MEDgle does not recommend any particular type of physician or claim to be complete or accurate in the providers and specialties suggested. web search results for 'g-csf'? Results 1 - 50 - g-csf Granulocyte colony-stimulating factor - Wikipedia, the free encyclopedia CSF3; G-CSF; GCSF; MGC45931. External IDs. OMIM: 138970 MGI: ... Granulocyte colony-stimulating factor (G-CSF or GCSF) is a colony-stimulating factor hormone. ... http://en.wikipedia.org/wiki/Granulocyte-colony_stimulating_factor   en.wikipedia.org - summary Complete Filgrastim (G-CSF) information from Drugs.com All about Filgrastim (G-CSF). View complete and up to date Filgrastim (G-CSF) information - part of the Drugs.com trusted medication database. http://www.drugs.com/ppa/filgrastim-g-csf.html   www.drugs.com - summary G-CSF Drugs Prevent Chemo Complication - National Cancer Institute A combined analysis confirmed that cancer patients receiving chemotherapy are less likely to suffer febrile neutropenia when they also receive drugs that stimulate ... http://www.nci.nih.gov/clinicaltrials/results/neutropenia0807   www.nci.nih.gov - summary Neupogen (Filgrastim) Drug Information: Uses, Side Effects, Drug ... Learn about the prescription medication Neupogen (Filgrastim), drug uses and information, side effects, drug ... G-CSF is not species specific and has ... http://www.rxlist.com/cgi/generic/filgrastim.htm   www.rxlist.com - summary An extended window of opportunity for G-CSF treatment in cerebral ischemia Granulocyte-colony stimulating factor (G-CSF) is a cytokine that stimulates ... The explanations for the effects of G-CSF on the CNS appear as a combination of ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1633735   www.pubmedcentral.nih.gov - summary G-CSF potently inhibits osteoblast activity and CX...[Blood. 2005 ... PubMed is a service of the U.S. National Library of Medicine that includes over 18 million citations from MEDLINE and other life science journals for biomedical ... http://www.ncbi.nlm.nih.gov/pubmed/16037394/   www.ncbi.nlm.nih.gov - summary G-CSF and GM-CSF for treating or preventing neonatal infections G-CSF or GM-CSF given as prophylaxis with the aim of reducing ... G-CSF has been used in these studies because of its powerful ... tended to use G-CSF. ... http://www.nichd.nih.gov/cochrane/Carr/CARR.HTM   www.nichd.nih.gov - summary Granulocyte colony-stimulating factor receptor - Wikipedia, the free ... The G-CSF-R is a transmembrane receptor that consists of an extracellular ligand ... GCSF-R ligand-binding is associated with dimerization of the receptor and signal ... http://en.wikipedia.org/wiki/G-CSF_receptor   en.wikipedia.org - summary Regulation of the MAD1 promoter by G-CSF We observed that MAD1 is directly activated by G-CSF in promyelocytic cell lines. ... pLNCX-GCSF/Rm0) were provided by I. Touw (Rotterdam University, The Netherlands) ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=2275144   www.pubmedcentral.nih.gov - summary Definition of G-CSF - NCI Dictionary of Cancer Terms Virtual and Standard Colonoscopy Both Accurate. NCI Responds to Hurricanes. The Nation's Investment in Cancer ... G-CSF. Granulocyte colony-stimulating factor. ... http://www.nci.nih.gov/Templates/db_alpha.aspx?CdrID=46075   www.nci.nih.gov - summary G-CSF induced hepatitis and pancreatitis in a HIV-seropositive patient. Disulone and G-CSF were interrupted, which induced an improvement of hepatic and ... The definitive arrest of G-CSF ledd to a decrease to sub-normal values of ... http://gateway.nlm.nih.gov/MeetingAbstracts/ma?f=102208455.html   gateway.nlm.nih.gov - summary The receptor for Granulocyte-colony stimulating factor (G-CSF) is ... Figure 1 gives examples of G-CSF receptor expression outside the developing CNS ... First, it adds a further dimension to the presence of the GCSF system in ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=2329616   www.pubmedcentral.nih.gov - summary G-CSF factor stem-loop destabilising element - Wikipedia, the free ... In unstimulated cells G-CSF mRNA is unstable but becomes stabilised in response ... Rfam page for G-CSF factor stem-loop destabilising element (SLDE) ... http://en.wikipedia.org/wiki/G-CSF_factor_stem-loop_destabilising_element   en.wikipedia.org - summary WHO | G-CSF and GM-CSF for treating or preventing neonatal infections ... factor (G-CSF), are naturally occurring cytokines that stimulate the production ... G-CSF or GM-CSF given as prophylaxis with the aim of reducing the incidence of ... http://www.who.int/rhl/newborn/reviews/cd003066/en/index.html   www.who.int - summary The hematopoietic factor G-CSF is a neuronal ligand that counteracts ... G-CSF displays strong antiapoptotic activity in mature neurons and activates ... product length 280 bp), and G-CSF (GCSF-790s, GGAGCTCTAAGCTTCTAGATC; GCSF-1154as, ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pub...   www.pubmedcentral.nih.gov - summary Dimerization of the extracellular domain of granul...[Biochemistry ... PubMed is a service of the U.S. National Library of Medicine that includes over 18 million citations from MEDLINE and ... stimulating factor (G-CSF) binds to ... http://www.ncbi.nlm.nih.gov/pubmed/8664280   www.ncbi.nlm.nih.gov - summary Close Association between Clearance of Recombinant Human Granulocyte ... G-CSF receptors on neutrophils were detected by flow cytometry with biotinylated ... The number of G-CSF receptor-positive neutrophils was obtained by comparing the ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=89014   www.pubmedcentral.nih.gov - summary Clinical Study: 04-H-0179, Peripheral Blood Hematopoietic Progenitor ... Clinical Study Summary ... Traditionally, the growth factor G-CSF has been given to ... Studies indicate that G-CSF used together with a drug called ... http://clinicalstudies.info.nih.gov/cgi/detail.cgi?A_2004-H-0179.html   clinicalstudies.info.nih.gov - summary Dedifferentiated chondrosarcoma with leukocytosis and elevation of ... Granulocyte-colony stimulating factor (G-CSF) enhances differentiation along the ... Consequently, G-CSF is known to function as a hematopoietic growth factor and it ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1526734   www.pubmedcentral.nih.gov - summary A successful strategy for decreasing costs associated with the use of ... G-CSF was discontinued when ANC greater than 1000. ... From June through August, 1995, 23 patients received G-CSF at some point during 25 admissions. ... http://gateway.nlm.nih.gov/MeetingAbstracts/ma?f=102218263.html   gateway.nlm.nih.gov - summary Spontaneous production of granulocyte colony-stimu...[J Immunol. 1994 ... PubMed is a service of the U.S. National Library of Medicine that includes over 18 million citations from MEDLINE and ... spontaneous produced G-CSF mRNA and ... http://www.ncbi.nlm.nih.gov/pubmed/7522243   www.ncbi.nlm.nih.gov - summary Intas Biopharmaceuticals - Wikipedia, the free encyclopedia It launched its first product Neukine injection (Filgrastim)/ GCSF in July 2004. ... [1] Biosimilar G-CSF: Cooperation on Three Continents : April 2008 ... http://en.wikipedia.org/wiki/Intas_Biopharmaceuticals   en.wikipedia.org - summary Transient spleen enlargement in peripheral blood progenitor cell donors ... Typically 10 to 16 ?g/kg of G-CSF are given subcutaneously daily for 4 to 6 days ... The administration of G-CSF to healthy PBPC concentrates donors is very safe, ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=493285   www.pubmedcentral.nih.gov - summary AIDSInfo Press Release G-CSF will lessen their chances of infection and reduce their need for ... G-CSF is indicated for use with myelosuppressive chemotherapy, a type of ... http://www.aidsinfo.nih.gov/aprs/release.aspx?an=A00223§ion=SearchTopic   www.aidsinfo.nih.gov - summary Crystallization of a 2:2 complex of granulocyte-colony stimulating ... A model of GCSF?Ig-CRH based on the structure of the vIL6?gp130 complex is ... mM Tris?HCl buffer pH 7.0 containing 0.2 M NaCl and excess G-­CSF was eliminated. ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1952362   www.pubmedcentral.nih.gov - summary Crystal structure of canine and bovine granulocyte...[J Mol Biol. 1993 ... PubMed is a service of the U.S. National Library of Medicine that includes over 18 million citations from MEDLINE and ... G-CSF is a member of the cytokine ... http://www.ncbi.nlm.nih.gov/pubmed/7504736   www.ncbi.nlm.nih.gov - summary Dedifferentiated liposarcoma with leukocytosis. A case report of G-CSF ... Granulocyte-colony-stimulating factor (G-CSF) enhances differentiation along the ... Consequently, G-CSF is known to function as a hematopoietic growth factor and it ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pub...   www.pubmedcentral.nih.gov - summary Granulocyte Colony-Stimulating Factor and Azole Antifungal Therapy in ... ... colony-stimulating factor (G-CSF) is a recombinant human ... G-CSF ameliorates ... with SCH56592 at 25 mg/kg/dose, GCSF at 125 ?g/kg/dose, or both ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=105859   www.pubmedcentral.nih.gov - summary G-CSF treatment in AIDS patients. By adding G-CSF to the antibiotics she survived the sepsis as antibiotic therapy ... G-CSF treatment did not show any side effects. ... http://gateway.nlm.nih.gov/MeetingAbstracts/ma?f=102202235.html   gateway.nlm.nih.gov - summary eMedicine - Kostmann Disease : Article by Michael S Tankersley Originally described in 1956 in a Swedish kindred, Kostmann disease is a rare ... An abnormal G-CSF?induced intracellular signal transduction pathway has been ... http://www.emedicine.com/ped/topic1260.htm   www.emedicine.com - summary Risk of myelodysplastic syndrome and acute myeloid...[Semin Hematol ... PubMed is a service of the U.S. National Library of Medicine that includes over 18 million citations from MEDLINE and ... stimulating factor (G-CSF) has had ... http://www.ncbi.nlm.nih.gov/pubmed/11957196   www.ncbi.nlm.nih.gov - summary Aggregation of granulocyte-colony stimulating factor in vitro involves ... Structurally, G-CSF belongs to a larger group of growth factors, which share a ... Atomic structure of the GCSF-receptor complex showing a new cytokine-receptor ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=2253479   www.pubmedcentral.nih.gov - summary G-CSF down-regulation of CXCR4 expression identified as a mechanism for ... When exposed to G-CSF, murine Gr1+ bone marrow myeloid cells display a time ... during hematopoietic stem cell mobilization induced by GCSF or cyclophosphamide. ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1895847   www.pubmedcentral.nih.gov - summary Tryptophan 650 of human granulocyte colony-stimula...[Blood. 1996 ... PubMed is a service of the U.S. National Library of Medicine that includes over 18 million citations from MEDLINE ... pathway from G-CSF receptor signaling ... http://www.ncbi.nlm.nih.gov/pubmed/8630373   www.ncbi.nlm.nih.gov - summary Granulocyte Colony-Stimulating Factor Enhances Endotoxin-Induced ... G-CSF was injected subcutaneously at 12 ?g/kg for 3 days and was administered ... Pretreatment with G-CSF enhanced these decreases induced by LPS. ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=105768   www.pubmedcentral.nih.gov - summary G-CSF potently inhibits osteoblast activity and CXCL12 mRNA expression ... We previously showed that G-CSF receptor (G-CSFR) expression ... CD26 is essential for normal GCSF-induced progenitor cell mobilization as ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pub...   www.pubmedcentral.nih.gov - summary Expression of G-CSF receptor on myeloid progenitors. Expression of G-CSF receptor on myeloid progenitors. Tsuji K, Ebihara Y. ... Although granulocyte colony-stimulating factor (G-CSF) has been reported to act ... http://www.ncbi.nlm.nih.gov/pubmed/11911419   www.ncbi.nlm.nih.gov - summary G-CSF/SCF reduces inducible arrhythmias in the infarcted heart ... Although G-CSF/SCF led to a twofold increased, potentially proarrhythmic homing ... An enhanced expression of the G-CSF receptor demonstrated in cardiomyocytes and ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=2118062   www.pubmedcentral.nih.gov - summary eMedicine - Acute Febrile Neutrophilic Dermatosis : Article Excerpt by ... Acute febrile neutrophilic dermatosis, also termed Sweet syndrome, is a reactive process characterized by the abrupt ... G-CSF suppresses apoptosis and ... http://www.emedicine.com/derm/byname/acute-febrile-neutrophilic-dermatosis.htm   www.emedicine.com - summary Use of glycosylated recombinant human G-CSF (lenograstim) during and/or ... Patients who received G-CSF after chemotherapy had a shorter time to neutrophil ... G-CSF (lenograstim, GRANOCYTE; Chugai-Aventis, Antony, France) was given at the ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1895135   www.pubmedcentral.nih.gov - summary GEO Accession viewer Granulocyte-colony stimulating factor (G-CSF) is used to boost granulocyte ... Significantly-regulated genes post-GCSF mobilization: Annotated genes (FDR 5 ... http://www.ncbi.nlm.nih.gov/projects/geo/query/acc.cgi?acc=GSE7400   www.ncbi.nlm.nih.gov - summary Suppressor of cytokine signaling 3 controls lysosomal routing of G-CSF ... Granulocyte colony-stimulating factor (G-CSF) is the main cytokine involved in ... Activation of the G-CSF receptor (G-CSFR), a member of the class I cytokine ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1847666   www.pubmedcentral.nih.gov - summary Talk:G-CSF factor stem-loop destabilising element - Wikipedia, the free ... Talk:G-CSF factor stem-loop destabilising element. From Wikipedia, the free encyclopedia ... This article has not yet received a rating on the quality scale. ... http://en.wikipedia.org/wiki/Talk:G-CSF_factor_stem-loop_destabilising_element   en.wikipedia.org - summary G-CSF and AMD3100 mobilize monocytes into the blood that stimulate ... Combination treatment with G-CSF and AMD3100 resulted in the earliest and most ... Recombinant human G-CSF, a generous gift from Amgen (Thousand Oaks, CA), was ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pub...   www.pubmedcentral.nih.gov - summary Pegylated granulocyte colony-stimulating factor mo...[Haematologica ... PubMed is a service of the U.S. National Library of Medicine that includes over 18 ... Additionally, sorted pegylated-G-CSF-mobilized hematopoietic stem cells ... http://www.ncbi.nlm.nih.gov/pubmed/18268278?ordinalpos=1&ito...   www.ncbi.nlm.nih.gov - summary STAT5 Is an Ambivalent Regulator of Neutrophil Homeostasis G-CSF is recognized as the primary extracellular regulator of both basal and ... The importance of G-CSF to in vivo granulopoiesis was demonstrated ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1939728   www.pubmedcentral.nih.gov - summary CXCR2 ligands and G-CSF mediate PKC?-induced intraepidermal inflammation G-CSF receptor?deficient mice have decreased numbers of circulating neutrophils ... Systemic levels of G-CSF and GM-CSF were measured by ELISA in the serum of K5 ... http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pub...   www.pubmedcentral.nih.gov - summary Talk:Granulocyte colony-stimulating factor - Wikipedia, the free ... If we are calling G-CSF the physiological chemical, and there is a separate ... a drug that has been made to immitate GCSF's action (even by exact duplication) ... http://en.wikipedia.org/wiki/Talk:Granulocyte_colony-stimulating_factor   en.wikipedia.org - summary Structure Summary, 2D9Q, 37670 MMDB is a database of three-dimensional biomolecular structure at ... Crystal Structure Of The Human Gcsf-Receptor Signaling Complex. Deposition: 2005/12/12 ... http://www.ncbi.nlm.nih.gov/Structure/mmdb/mmdbsrv.cgi?uid=2D9Q   www.ncbi.nlm.nih.gov - summary eMedicine - Neutropenia : Article by John E Godwin Neutropenia is a decrease in circulating neutrophils in the peripheral blood. ... respond clinically to G-CSF are treated for life. ... The treatment is G-CSF. ... http://www.emedicine.com/med/topic1640.htm   www.emedicine.com - summary show more 1  2

Chat with eNurse Kim about 'g-csf' or something else! quick facts related diagnosis category hematological oncology musculoskeletal and connective tissue disorders